Housekeeping gene expression variability in differentiating and non-differentiating 3T3-L1 cells.
Journal Information
Full Title: Adipocyte
Abbreviation: Adipocyte
Country: Unknown
Publisher: Unknown
Language: N/A
Publication Details
Related Papers from Same Journal
Transparency Score
Transparency Indicators
Click on green indicators to view evidence textCore Indicators
"mouse cdna primer sequences of the 10 reference genes used for rt-qpcr [ comment ] gene symbol primer sequences (5'-3') accession number product size (bp) primer efficiency (%) r 2 value references of primer sequences actb f: agccatgtacgtagccatcc nm_007393 5 250 93 1 0 9987 - r: tttgatgtcacgcacgattt gapdh f: aggtcggtgtgaacggatttg nm_001289463 1 123 87 6 0 9999 - r: tgtagaccatgtagttgaggtca rn18s f: gcaattattccccatgaacg nr_003278 3 123 90 3 0 9856 [ ] r: ggcctcactaaaccatccaa hmbs f: atgagggtgattcgagtggg nm_001110251 1 134 88 9 0 9864 [ ] r: ttgtctcccgtggtggacata ppia f: caggtccatctacggagaga nm_008907 2 146 90 3 0 9990 [ ] r: catccagccattcagtcttg b2m f: atacgcctgcagagttaagc nm_009735 3 70 87 9 0 9838 [ ] r: tcacatgtctcgatcccagt tbp f: ccaatgactcctatgaccccta nm_013684 3 104 98 8 0 9998 [ ] r: cagccaagattcacggtaga tfrc f: gtttctgccagccccttattat nm_011638 4 152 102 2 0 9994 [ ] r: gcaaggaaaggatatgcagca nono f: tgctcctgtgccacctggtactc nm_023144 2 170 94 5 0 9995 [ ] r: ccggagctggacggttgaatgc rpl13a f: ggctgccgaagatggcggag nm_009438 5 131 93 8 0 9995 [ ] r: gccttcacagcgtacgaccacc heatmap images of the expression of the 10 genes included in the analysis of the nd and di groups were generated using heatmapper [ ].; the data compiled and calculated as part of this study are available from the biostudies database ( https://www ebi ac uk/biostudies ) under accession number s-bsst1110."
"Disclosure statement No potential conflict of interest was reported by the authors."
Additional Indicators
Assessment Info
Tool: rtransparent
OST Version: N/A
Last Updated: Aug 05, 2025