Housekeeping gene expression variability in differentiating and non-differentiating 3T3-L1 cells.

"mouse cdna primer sequences of the 10 reference genes used for rt-qpcr [ comment ] gene symbol primer sequences (5'-3') accession number product size (bp) primer efficiency (%) r 2 value references of primer sequences actb f: agccatgtacgtagccatcc nm_007393 5 250 93 1 0 9987 - r: tttgatgtcacgcacgattt gapdh f: aggtcggtgtgaacggatttg nm_001289463 1 123 87 6 0 9999 - r: tgtagaccatgtagttgaggtca rn18s f: gcaattattccccatgaacg nr_003278 3 123 90 3 0 9856 [ ] r: ggcctcactaaaccatccaa hmbs f: atgagggtgattcgagtggg nm_001110251 1 134 88 9 0 9864 [ ] r: ttgtctcccgtggtggacata ppia f: caggtccatctacggagaga nm_008907 2 146 90 3 0 9990 [ ] r: catccagccattcagtcttg b2m f: atacgcctgcagagttaagc nm_009735 3 70 87 9 0 9838 [ ] r: tcacatgtctcgatcccagt tbp f: ccaatgactcctatgaccccta nm_013684 3 104 98 8 0 9998 [ ] r: cagccaagattcacggtaga tfrc f: gtttctgccagccccttattat nm_011638 4 152 102 2 0 9994 [ ] r: gcaaggaaaggatatgcagca nono f: tgctcctgtgccacctggtactc nm_023144 2 170 94 5 0 9995 [ ] r: ccggagctggacggttgaatgc rpl13a f: ggctgccgaagatggcggag nm_009438 5 131 93 8 0 9995 [ ] r: gccttcacagcgtacgaccacc heatmap images of the expression of the 10 genes included in the analysis of the nd and di groups were generated using heatmapper [ ].; the data compiled and calculated as part of this study are available from the biostudies database ( https://www ebi ac uk/biostudies ) under accession number s-bsst1110."

"Disclosure statement No potential conflict of interest was reported by the authors."